Analyze Data Workflow Shared Data Help User
Using 0 bytes
Published Histories | vboeva | Nebula test 2014 TF
Import history

Galaxy History ' Nebula test 2014 TF'


DatasetAnnotation
None: H3K27ac.bam
763.9 Mb
format: bam, database: hg19
Binary bam alignments file
None: H3K27ac.bam
763.9 Mb
format: bam, database: hg19
Binary bam alignments file
None: H3K27ac.bam
763.9 Mb
format: bam, database: hg19
Binary bam alignments file
None: input.bam
713.7 Mb
format: bam, database: hg19
Binary bam alignments file
None: H3K27ac.bam
763.9 Mb
format: bam, database: hg19
Binary bam alignments file
None: H3K27ac.bam
763.9 Mb
format: bam, database: hg19
Binary bam alignments file
None: H3K27ac.bam
763.9 Mb
format: bam, database: hg19
Binary bam alignments file
None: H3K27ac.bam
763.9 Mb
format: bam, database: hg19
Binary bam alignments file
None: H3K27ac.bam
763.9 Mb
format: bam, database: hg19
Binary bam alignments file
None: H3K27ac.bam
763.9 Mb
format: bam, database: hg19
Binary bam alignments file
None: H3K27ac.bam
763.9 Mb
format: bam, database: hg19
Binary bam alignments file
None: H3K27ac.bam
763.9 Mb
format: bam, database: hg19
Binary bam alignments file
None: H3K27ac.bam
763.9 Mb
format: bam, database: hg19
Binary bam alignments file
None: H3K27ac.bam
763.9 Mb
format: bam, database: hg19
Binary bam alignments file
None: H3K27ac.bam
763.9 Mb
format: bam, database: hg19
Binary bam alignments file
None: H3K27ac.bam
763.9 Mb
format: bam, database: hg19
Binary bam alignments file
None: H3K27ac.bam
763.9 Mb
format: bam, database: hg19
Binary bam alignments file
1: Input.chr1.bam
133.7 Mb
format: bam, database: mm9
Binary bam alignments file
2: Probesets_FC1.5_10022011.txt
16,142 lines
format: txt, database: mm9
gene Fold.Change pvalue.adjust FC=1.5
A 0610010O12Rik 2.54 down-regulated down-regulated 474
A 0910001A06Rik 0.556666667 up-regulated no-response 14871
A 1110002B05Rik 0.51 up-regulated up-regulated 796
A 1110003E01Rik 1.575 down-regulated
A 1110006G14Rik 1.68 down-regulated
3: TF.chr1.bam
116.1 Mb
format: bam, database: mm9
Binary bam alignments file
4: flagstat on data 3
11 lines
format: txt, database: mm9
1789569 + 0 in total (QC-passed reads + QC-failed reads)
0 + 0 duplicates
1789569 + 0 mapped (100.00%:-nan%)
0 + 0 paired in sequencing
0 + 0 read1
0 + 0 read2
5: flagstat on data 1
11 lines
format: txt, database: mm9
2057002 + 0 in total (QC-passed reads + QC-failed reads)
0 + 0 duplicates
2057002 + 0 mapped (100.00%:-nan%)
0 + 0 paired in sequencing
0 + 0 read1
0 + 0 read2
6: TF_FastQC.html
8.2 Kb
format: html, database: mm9
HTML file
7: Input_FastQC.html
8.2 Kb
format: html, database: mm9
HTML file
8: MACS on data 1 and data 3 (peaks: bed)
1,521 regions
format: bed, database: mm9
1.Chrom2.Start3.End4.Name5
chr130497833049902MACS_peak_160.85
chr134360823436257MACS_peak_253.05
chr144079714408348MACS_peak_3335.32
chr144148914415030MACS_peak_465.92
chr146134204613617MACS_peak_577.61
chr147974804797791MACS_peak_697.99
9: MACS on data 1 and data 3 (peaks: interval)
1,522 regions, 24 comments
format: interval, database: mm9
1.Chrom2.Start3.End456789
#peaks file
# This file is generated by MACS version 1.4.2 20120305
# ARGUMENTS LIST:
# name = MACS_test
# format = BAM
# ChIP-seq file = /bioinfo/http/prod/hosted/nebula.curie.fr/galaxy-dist/database/files/027/dataset_27821.dat
10: MACS on data 1 and data 3 (negative peaks: interval)
19 regions, 2 comments
format: interval, database: mm9
1.Chrom2.Start3.End45678
#negative peaks file
#chrstartendlengthsummittags-10*log10(pvalue)fold_enrichment
chr12486472124864820100511192.6622.87
chr1136117629136117743115581267.0314.46
chr1144156983144157211229891250.8011.26
chr11608943101608945262171241254.0615.43
11: MACS on data 1 and data 3 (treatment: wig)
~7,200,000 lines
format: wig, database: mm9
12
track type=wiggle_0 name="MACS_test_treat_chr1" description="Extended tag pileup from MACS version 1.4.2 20120305 for every 10 bp"
variableStep chrom=chr1 span=10
30002811
30002911
30003011
30003111
12: MACS on data 1 and data 3 (control: wig)
~8,300,000 lines
format: wig, database: mm9
12
track type=wiggle_0 name="MACS_test_control_chr1" description="Extended tag pileup from MACS version 1.4.2 20120305 for every 10 bp"
variableStep chrom=chr1 span=10
30003611
30003711
30003811
30003911
13: MACS on data 1 and data 3 (html report)
4.8 Kb
format: html, database: mm9
HTML file
14: Subset for Control
100.6 Mb
format: bam, database: mm9
Info:
-----------------
Binary bam alignments file
15: Subset for ChIP
99.8 Mb
format: bam, database: mm9
Info:
-----------------
Binary bam alignments file
16: FindPeaks for TF (peaks: .peaks)
143,948 lines
format: txt, database: mm9
30 chr1 3017158 3017589 3017522 3.0
32 chr1 3018446 3018754 3018626 4.0
35 chr1 3019095 3019377 3019197 3.0
41 chr1 3021979 3022186 3022082 3.0
52 chr1 3027070 3027323 3027212 5.0
58 chr1 3034820 3034979 3034885 3.0
17: FindPeaks for TF (report)
51 lines
format: log, database: mm9
Version: Vancouver Short Read Analysis Package 4.0.9.2
Version: Initializing class FindPeaks $Revision: 1797 $
Version: Initializing class Parameters $Revision: 1838 $
Info: Log File: /scratch/594309.torque.curie.fr/tmp.tQJEJS3Ggt/TF.log
Info: * Output directory : /scratch/594309.torque.curie.fr/tmp.tQJEJS3Ggt/
Info: * Naming files as : TF
18: FindPeaks for TF (wig)
data
format: gzip, database: mm9
display at UCSC main
19: FindPeaks for Input (peaks: .peaks)
150,592 lines
format: txt, database: mm9
5 chr1 3001383 3001570 3001462 3.0
7 chr1 3002244 3002722 3002606 3.462
8 chr1 3002722 3002957 3002847 4.0
30 chr1 3016586 3016787 3016700 4.0
32 chr1 3017617 3017843 3017730 3.0
33 chr1 3018441 3018718 3018521 3.0
20: FindPeaks for Input (report)
52 lines
format: log, database: mm9
Version: Vancouver Short Read Analysis Package 4.0.9.2
Version: Initializing class FindPeaks $Revision: 1797 $
Version: Initializing class Parameters $Revision: 1838 $
Info: Log File: /scratch/594310.torque.curie.fr/tmp.H9fNjHEccm/Input.log
Info: * Output directory : /scratch/594310.torque.curie.fr/tmp.H9fNjHEccm/
Info: * Naming files as : Input
21: FindPeaks for Input (wig)
data
format: gzip, database: mm9
display at UCSC main
22: Peak height distribution (stats)
49 lines
format: tabular, database: mm9
Info: null device
1
12345
peak height# peaks in ChIP# peaks in Control#control/chip
370771782181.10522671715816
442002454931.08311508975763
518376180870.984272964736613
6729862370.854617703480406
7266817650.661544227886057
23: Peak height distribution (png)
7.0 Kb
format: png, database: mm9
Info: null device
1
Image in png format
24: filtered peaks for ChIP (.bed)
898 regions, 1 comments
format: bed, database: mm9
1.Chrom2.Start3.End4.Name56.Strand78910111213
track name='FP_FilteredPeaks_t11' description='FP_FilteredPeaks_t11'
chr144076844408653440810023.158+44076844408653255,120,1119690
chr146132404613806461352211.0+46132404613806255,120,1115660
chr147974214797907479761810.624+47974214797907255,120,1114860
chr154324305432671543253917.0+54324305432671255,120,1112410
chr191318589132410913201213.402+91318589132410255,120,1115520
25: filtered peaks for Control (.bed)
50,423 regions, 1 comments
format: bed, database: mm9
1.Chrom2.Start3.End4.Name56.Strand78910111213
track name='FP_peaks_control' description='FP_peaks_control'
chr13002722300295730028474.0+30027223002957255,120,1112350
chr13016586301678730167004.0+30165863016787255,120,1112010
chr13019507301997530197615.320+30195073019975255,120,1114680
chr13064226306452030643354.0+30642263064520255,120,1112940
chr13070216307054430704414.0+30702163070544255,120,1113280
26: Wig-to-bigWig on data 11
16.6 Mb
format: bigwig, database: mm9
display at UCSC main
Binary UCSC BigWig file
27: central regions for filtered peaks for ChIP (.bed)
898 regions
format: bed, database: mm9
1.Chrom2.Start3.End4.Name
chr14408000440820023.158
chr14613422461362211.0
chr14797518479771810.624
chr15432439543263917.0
chr19131912913211213.402
chr19273175927337510.931
28: central regions for MACS on data 1 and data 3 (peaks: interval)
1,521 regions
format: bed, database: mm9
1.Chrom2.Start3.End4.Name
chr1304974330499438
chr1343603634362369
chr14407994440819443
chr1441483644150369
chr14613461461366114
chr14797517479771717
29: Fasta file
898 sequences
format: fasta, database: mm9
>chr1:4408000-4408200
GTTTTACTCCCTAATTGTTGTCCCTGTTGTTCTAGCCCCACAGAATGGCAGAGAACATCATGGTGGTGGAAGTGTGTGGGACAGGCTACTCAACTCATGCTAGACAGACAACATAAAAAGGGAAGTGGAATAAGAAAAAGGAAGAGATGGAGGAAAAGAGATAAGAAGGAGTGGCTGGATATTCCATAAGGCTTACCCTT
>chr1:4613422-4613622
CCATGACAGTTGTTTTAAATGCAGAAAACAAGAGATTGCCATTTATGGACAGTAAGTGTGTTCAAGTACAGTGTCGAGTTTTGTGTGGTGATAAGGCCAGAGCAGGAAGCCCGAGGGGCCAGGAAGGAAGTGCTCTCAAGCTTGGAGTGGCAGGGTTGAACTGTGAGCAGGGCAGGCTCAGGGCTGCAGCTAGACAGAAA
>chr1:4797518-4797718
ATATGCAATAAATTCAGCGCTGTGCAGAAGGGTGGCGATTTTGCCCCGTGTTCAAAACGGCTATATTTCAATGAATACCTGTCCTTTAGTTAATAACGTTGACCTGCCTGGGGAAGTGAAATCGGGAGTCACGCGTCAAGCGCGCAGGGGACCACAGCAAGAGCTCGCCCCGCCTAGCCGCGGTCCCAGCAGCGGTCCCT
30: Fasta file
1,521 sequences
format: fasta, database: mm9
>chr1:3049743-3049943
accgccaagttcctgcttccccgtgtagctgccaaaagaaagaatttctattgccccccccctcccataagtacttctccttttgcttgtatttccccatccctccactgataagtatctgtacttccccgtttccttgtgcaattctactgccccatccttcctgctgaaaggcacttccccttttgcttgtgtattta
>chr1:3436036-3436236
accaccaagttcctgcttccccctgtaactgcctaagaatgtgcaattctattgccccccacctcccactgataagtacttctcctttgcttgtattgccccacccctcccgctgataagcatctatacttccccttttccttgttcaattctactgccccatccttcctgctgaaaggaacttccccttttgctcctgc
>chr1:4407994-4408194
TCAGAGGTTTTACTCCCTAATTGTTGTCCCTGTTGTTCTAGCCCCACAGAATGGCAGAGAACATCATGGTGGTGGAAGTGTGTGGGACAGGCTACTCAACTCATGCTAGACAGACAACATAAAAAGGGAAGTGGAATAAGAAAAAGGAAGAGATGGAGGAAAAGAGATAAGAAGGAGTGGCTGGATATTCCATAAGGCTT
31: row ChIPmunk output for FP_200bp (log)
869 lines
format: txt, database: mm9
DUMP|ru_genetika.ChIPHorde
PROG|ru_genetika.ChIPHorde
INFO|motif N0
LENG|14
KDIC|8.966403386194258
A|268.0 421.00000000000017 449.0 575.9999999999994 163.0 687.9999999999995 35.0 24.000000000000007 825.0000000000001 871.9999999999995 38.0 96.00000000000014 105.0 285.9999999999998
32: motifs for FP_200bp(txt)
5 lines
format: txt, database: mm9
Motif 1
A| 268 421 449 575 163 687 35 24 825 871 38 96 105 285
C| 182 101 74 5 120 44 0 1 31 2 101 74 130 188
G| 339 250 319 245 600 151 858 868 42 4 755 29 592 336
T| 109 125 56 71 14 14 4 5 0 19 2 698 70 88
33: motifs for FP_200bp(png)
106.0 Kb
format: png, database: mm9
Image in png format
34: row ChIPmunk output for MACS_200bp (log)
1,387 lines
format: txt, database: mm9
DUMP|ru_genetika.ChIPHorde
PROG|ru_genetika.ChIPHorde
INFO|motif N0
LENG|14
KDIC|8.896265716622068
A|393.0000000000002 617.0000000000002 670.0000000000002 821.0000000000003 212.0 1019.0000000000001 48.000000000000014 45.0 1252.999999999999 1261.9999999999986 70.0 157.99999999999997 150.99999999999994 398.00000000000006
35: motifs for MACS_200bp(txt)
5 lines
format: txt, database: mm9
Motif 1
A| 393 617 670 821 212 1019 48 45 1252 1261 70 157 150 398
C| 255 134 115 6 200 57 0 0 50 1 133 118 196 272
G| 528 372 448 402 889 228 1256 1272 14 43 1115 70 843 506
T| 143 196 86 90 18 15 14 1 2 13 0 972 128 143
36: motifs for MACS_200bp(png)
104.2 Kb
format: png, database: mm9
Image in png format
37: Peak location distribution (png)
123.0 Kb
format: png, database: mm9
Image in png format
38: Peak location distribution (stats)
52 lines
format: tabular, database: mm9
12345678910
Dist_TSS % genes w/ a peak in ChIP % genes w/ a peak in control % down-regulated genes w/ a peak in ChIP % no-response genes w/ a peak in ChIP % up-regulated genes w/ a peak in ChIP % down-regulated genes w/ a peak in Control % no-response genes w/ a peak
in Control % up-regulated genes w/ a peak in Control
000000000
10000.008541449878598680.000737079431148110.007984031936127740.006774060305658820.027283511269276400.0008261049153242460.00118623962040332
20000.009928893513701010.001214013180714530.009980039920159680.007847996695580340.030842230130486400.001239157372986370.00237247924080664
30000.01070933055844610.00190773499826570.009980039920159680.008343659644774890.032028469750889700.002230483271375460.00237247924080664
39: Peak location distribution (png)
98.5 Kb
format: png, database: mm9
Image in png format
40: Peak location distribution (stats)
27 lines
format: tabular, database: mm9
12345678910
Dist_TSS % genes w/ a peak in ChIP % genes w/ a peak in control % down-regulated genes w/ a peak in ChIP % no-response genes w/ a peak in ChIP % up-regulated genes w/ a peak in ChIP % down-regulated genes w/ a peak in Control % no-response genes w/ a peak
in Control % up-regulated genes w/ a peak in Control
000000000
2000.0042490461325008700.001996007984031940.003634861627426680.0142348754448399000
4000.006416926812348254.33576135969476e-050.005988023952095810.004956629491945480.020166073546856508.26104915324246e-050
6000.007327436697884150.000173430454387790.005988023952095810.00570012391573730.022538552787663100.0001652209830648490
41: Peaks Stats (png)
48.9 Kb
format: png, database: mm9
Image in png format
42: Annotated Peaks (ChIP)
932 lines
format: tabular, database: mm9
12345678910111213
ChromosomeStartEndMaxScoreDistTSSTypeTypeIntraRegFoldChangeDistTEGeneNameGeneCoordinates
chr144076844408653440810023.158-8778enhancerNANA1-127174Rp1chr1:4280926-4399322;4280926,4341990,4342282,4399250,-4283093,4342162,4342918,4399322,
chr146132404613806461352211-127028intergenicNAno-response1.000344567-132514Sox17chr1:4481008-4486494;4481008,4483180,4483852,4485216,4486371,-4482749,4483547,4483944,4486023,4486494,
chr147974214797907479761810.624-355promoterNANA1-39198Lypla1chr1:4797973-4836816;4797973,4798535,4818664,4820348,4822391,4827081,4829467,4831036,4835043,-4798063,4798567,4818730,4820396,4822462,4827155,4829569,4831213,4836816,
chr154324305432671543253917-146034intergenicNAno-response0.997768765-163675Oprk1chr1:5578573-5596214;5578573,5579085,5588670,5592332,-5578744,5579386,5589023,5596214,
chr191318589132410913201213.402157799intragenicintronno-response1.002420624-779271Sntg1chr1:8352741-9289811;8352741,8404283,8435107,8438060,8453474,8455517,8544805,8573285,8585492,8597150,8614859,8667887,8668017,8669153,8672053,8772843,8793997,
43: .LOG for Annotated Peaks
30 lines, 1 comments
format: tabular, database: mm9
123
ChIP:
Total genes : 25714
Total Sites: 898
TypeCountFrequency
5kbDownstream420.0451127819548872
enhancer1520.163265306122449
44: Annotated Peaks (Control)
909 lines
format: tabular, database: mm9
12345678910111213
ChromosomeStartEndMaxScoreDistTSSTypeTypeIntraRegFoldChangeDistTEGeneNameGeneCoordinates
chr190198171901984779019829610.916-24164enhancerNANA1-36894A730008H23Rikchr1:90161402-90174132;90161402,90164522,90171616,90173795,90173948,-90163233,90164601,90171674,90173860,90174132,
chr190198171901984779019829610.916-24142enhancerNANA1-42866Hjurpchr1:90155430-90174154;90155430,90164522,90165895,90166776,90169303,90171616,90173793,90173948,-90163233,90164601,90165988,90166874,90169340,90171672,90173860,90174154,
chr11794403411794409381794407149.06464763intergenicNAdown-regulated1.7359817Zfp238chr1:179375951-179380897;179375951,-179380897,
chr1173510323173510567173510436921113intragenicintronno-response1.012030021-5011Cd244chr1:173489323-173515447;173489323,173503811,173504223,173507373,173507945,173509229,173510888,173511773,173512934,-173489516,173504135,173504499,173507478,173
508100,173509301,173510951,173511830,173515447,
59: Filter on data 42
31 lines
format: tabular, database: mm9
Info: Filtering with (c7=="promoter" or c7=="immediateDownstream") and c9=="up-regulated",
kept 3.33% of 932 valid lines (932 total lines).
12345678910111213
chr116646269166475961664712726.047-181promoterNAup-regulated0.54-14282Tceb1chr1:16632845-16646946;16632845,16635766,16638035,16646902,-16633559,16635910,16638088,16646946,
chr116678102166788681667870611.48170immediateDownstreamjonctionup-regulated0.2-20980Ly96chr1:16678536-16699686;16678536,16681764,16690929,16696253,16699519,-16678700,16681854,16691004,16696306,16699686,
chr116678868166792041667907111.64535immediateDownstreamf_intronup-regulated0.2-20615Ly96chr1:16678536-16699686;16678536,16681764,16690929,16696253,16699519,-16678700,16681854,16691004,16696306,16699686,
chr123389930233905612339042614.536-412promoterNAup-regulated0.66-17164Ogfrl1chr1:23373262-23390014;23373262,23382568,23382826,23383009,23385564,23385810,23389653,-23377287,23382714,23382893,23383088,23385643,23385897,23390014,
chr134515797345163813451607110.731-519promoterNAup-regulated0.22-14553Ptpn18chr1:34516590-34530624;34516590,34519546,34519951,34520113,34520310,34525137,34526684,34527044,34528337,34528485,34528656,34528947,34529607,34530179,34530423,-34516761,
34519655,34520028,34520209,34520349,34525206,34526747,34527187,34528404,34528563,34528746,34529036,34529813,34530254,34530624,
60: central regions for Filter on data 42
31 regions
format: bed, database: mm9
1.Chrom2.Start3.End4.Name
chr1166469771664727726.047
chr1166785561667885611.48
chr1166789211667922111.64
chr1233902762339057614.536
chr1345159213451622110.731
chr1345167843451708430.076
61: Fasta file
31 sequences
format: fasta, database: mm9
>chr1:16646977-16647277
CCCCCAGCGGCCTACCCCTGTGGGTTCCGGGGCACAGAAAGGAATTACTTCCGTCGCGTCACAGCCGCTTTCTGTAACGCGCGGGAGACTGGTACCTGGCAAGGCCGAGACGCGATCTGCCGGTAACTTGCGTCTGGAGGAAGTGCGTTGTGGGCAGTAAAACAGGCCCATTTAAGAGACATCGCTACCAAATCCCAACCAATGAGATGCTAGGACTTCTTGGTTCCCAGAATGCAGCGCCATCCGGATCCAATTT
CTGCCGAGAAAAGCTGAGCCGGCGAGGCAGCAGTGCATTCTGGG
>chr1:16678556-16678856
TGGCGAGTTTAAAGTATCGGAGATATTAAATCATGTTGCCATTTATTCTCTTTTCGACGCTGCTTTCTCCCATATTGACTGAATCTGAGAAGCAACAGTGGTTCTGCAACTCCTCCGATGCAATTATTTCCTACAGTTATTGTGGTAAGTGGCCCGGCAACAAAGAGCTGCGGCGCCAACTATTTCGAGAGAAAGTTTCCACTGAACCTGAAGCTGGAGGGCTGGCAGGAACGCTGCTCCAGCAGTGAGCCCGCTG
CGGTGTGGGGTGGGGGTGGAGCAATGCCGACCACTTCCGGGTGC
62: row ChIPmunk output for FP_300bp_promoter_active (log)
134 lines
format: txt, database: mm9
DUMP|ru_genetika.ChIPHorde
PROG|ru_genetika.ChIPHorde
INFO|motif N0
LENG|14
KDIC|10.91295613536589
A|20.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 2.0 1.0 9.0 11.0 10.0
63: motifs for FP_300bp_promoter_active(txt)
15 lines
format: txt, database: mm9
Motif 1
A| 20 0 0 0 0 0 0 0 0 2 1 9 11 10
C| 3 23 0 0 29 30 4 25 12 15 9 15 15 8
G| 5 4 1 0 0 0 2 4 0 0 6 6 3 10
T| 3 4 30 31 2 1 25 2 19 14 15 1 2 3
Motif 2
64: motifs for FP_300bp_promoter_active(png)
311.5 Kb
format: png, database: mm9
Image in png format
65: Gene Stats (png)
51.5 Kb
format: png, database: mm9
Image in png format
66: Annotated Genes (ChIP)
25,715 lines
format: tabular, database: mm9
1234567891011121314151617181920212223242526272829303132333435363738394041
name chr start end strand Reg foldChange TF_score_Gene TF_distTSS_Gene TF_score_Promoter TF_distTSS_Promoter TF_score_ImmDown TF_distTSS_ImmDown TF_score_PromoterORImmDown TF_distTSS_PromoterORImmDown TF_score_Enhancer TF_distTSS_Enhancer TF_score_Intragen
ic TF_distTSS_Intragenic TF_score_GeneDownstream TF_distTSS_GeneDownstream TF_score_FirstExon TF_distTSS_FirstExon TF_score_FisrtIntron TF_distTSS_FisrtIntron TF_score_FirstExonAND>2000 TF_distTSS_FirstExonAND>2000 TF_score_FisrtIntronAND>2000 TF_distTSS_F
isrtIntronAND>2000 TF_score_Exons2,3,4,etc TF_distTSS_Exons2,3,4,etc TF_score_Exons2,3,4,etcAND>2000 TF_distTSS_Exons2,3,4,etcAND>2000 TF_score_Introns2,3,4,etc TF_distTSS_Introns2,3,4,etc TF_score_Introns2,3,4,etcAND>2000 TF_distTSS_Introns2,3,4,etcAND>20
00 TF_score_EIjunction TF_distTSS_EIjunction TF_score_EIjunctionAND>2000 TF_distTSS_EIjunctionAND>2000
Ucp3 chr7 107621499 107634941 1 no-response 0.979843327 0 10000000000 0 10000000000 0 10000000000 0 10000000000 0 10000000000 0 10000000000 0 10000000000 0 10000000000 0 10000000000 0 10000000000 0 10000000000 0 10000000000 0 10000000000 0 10000000000 0 10
000000000 0 10000000000 0 10000000000
67: .LOG for Annotated Genes
46 lines, 5 comments
format: tabular, database: mm9
1
Proportion of genes with a peak from the ChIP dataset in a given genomic region:
down-regulated:
Enh. Prom. Imm.Down. Intrag. GeneDown. F.Intron Exons 2,3,etc.Introns E.I.Junctions
0.0188235294117647 0.00470588235294118 0.00705882352941176 0.0211764705882353 0.00705882352941176 0.00941176470588235 0 0.0164705882352941 0
no-response:
Enh. Prom. Imm.Down. Intrag. GeneDown. F.Intron Exons 2,3,etc.Introns E.I.Junctions
68: Annotated Genes (Control)
25,715 lines
format: tabular, database: mm9
1234567891011121314151617181920212223242526272829303132333435363738394041
name chr start end strand Reg foldChange TF_score_Gene TF_distTSS_Gene TF_score_Promoter TF_distTSS_Promoter TF_score_ImmDown TF_distTSS_ImmDown TF_score_PromoterORImmDown TF_distTSS_PromoterORImmDown TF_score_Enhancer TF_distTSS_Enhancer TF_score_Intragen
ic TF_distTSS_Intragenic TF_score_GeneDownstream TF_distTSS_GeneDownstream TF_score_FirstExon TF_distTSS_FirstExon TF_score_FisrtIntron TF_distTSS_FisrtIntron TF_score_FirstExonAND>2000 TF_distTSS_FirstExonAND>2000 TF_score_FisrtIntronAND>2000 TF_distTSS_F
isrtIntronAND>2000 TF_score_Exons2,3,4,etc TF_distTSS_Exons2,3,4,etc TF_score_Exons2,3,4,etcAND>2000 TF_distTSS_Exons2,3,4,etcAND>2000 TF_score_Introns2,3,4,etc TF_distTSS_Introns2,3,4,etc TF_score_Introns2,3,4,etcAND>2000 TF_distTSS_Introns2,3,4,etcAND>20
00 TF_score_EIjunction TF_distTSS_EIjunction TF_score_EIjunctionAND>2000 TF_distTSS_EIjunctionAND>2000
Ucp3 chr7 107621499 107634941 1 no-response 0.979843327 0 10000000000 0 10000000000 0 10000000000 0 10000000000 0 10000000000 0 10000000000 0 10000000000 0 10000000000 0 10000000000 0 10000000000 0 10000000000 0 10000000000 0 10000000000 0 10000000000 0 10
000000000 0 10000000000 0 10000000000
85: Peaks Stats (png)
51.0 Kb
format: png, database: mm9
Image in png format
86: Annotated Peaks (ChIP)
932 lines
format: tabular, database: mm9
12345678910111213
ChromosomeStartEndMaxScoreDistTSSTypeTypeIntraRegFoldChangeDistTEGeneNameGeneCoordinates
chr144076844408653440810023.158-8778enhancerNANA1-127174Rp1chr1:4280926-4399322;4280926,4341990,4342282,4399250,-4283093,4342162,4342918,4399322,
chr146132404613806461352211-127028intergenicNAno-response1.000344567-132514Sox17chr1:4481008-4486494;4481008,4483180,4483852,4485216,4486371,-4482749,4483547,4483944,4486023,4486494,
chr147974214797907479761810.624-355promoterNANA1-39198Lypla1chr1:4797973-4836816;4797973,4798535,4818664,4820348,4822391,4827081,4829467,4831036,4835043,-4798063,4798567,4818730,4820396,4822462,4827155,4829569,4831213,4836816,
chr154324305432671543253917-146034intergenicNAno-response0.997768765-163675Oprk1chr1:5578573-5596214;5578573,5579085,5588670,5592332,-5578744,5579386,5589023,5596214,
chr191318589132410913201213.402157799intragenicintronno-response1.002420624-779271Sntg1chr1:8352741-9289811;8352741,8404283,8435107,8438060,8453474,8455517,8544805,8573285,8585492,8597150,8614859,8667887,8668017,8669153,8672053,8772843,8793997,
87: .LOG for Annotated Peaks
30 lines, 1 comments
format: tabular, database: mm9
123
ChIP:
Total genes : 25714
Total Sites: 898
TypeCountFrequency
5kbDownstream420.0451127819548872
enhancer1520.163265306122449
88: Annotated Peaks (Control)
908 lines
format: tabular, database: mm9
12345678910111213
ChromosomeStartEndMaxScoreDistTSSTypeTypeIntraRegFoldChangeDistTEGeneNameGeneCoordinates
chr117346548517346577917346559110-166promoterNAno-response1.004411374-17337Itln1chr1:173448254-173465425;173448254,173459251,173460624,173461164,173461636,173463496,173464884,173465351,-173448524,173459355,173460745,173461323,173461884,17346359
5,173464948,173465425,
chr11960327451960335731960329979-413025intergenicNAno-response1.000608752-610065Plxna2chr1:196446022-196643062;196446022,196469879,196475649,196538377,196572323,196575505,196577569,196578246,196580513,196588592,196590675,196593564,196606706,196
612760,196614972,196615914,196616304,196619922,196620566,196621016,196623100,196623733,196625703,196625968,196626694,196627236,196631096,196632475,196633695,196636255,196637050,196638259,-196446591,196471141,196475832,196538512,196572424,196575629,19657772
3,196578343,196580628,196588793,196590772,196593755,196606858,196612878,196615109,196616082,196616398,196620162,196620710,196621251,196623243,196624002,196625770,196626115,196626854,196627340,196631196,196632666,196633865,196636468,196637201,196643062,
89: Filter on data 86
31 lines
format: tabular, database: mm9
Info: Filtering with (c7=='promoter' or c7=='immediateDownstream') and c9=='up-regulated',
kept 3.33% of 932 valid lines (932 total lines).
12345678910111213
chr116646269166475961664712726.047-181promoterNAup-regulated0.54-14282Tceb1chr1:16632845-16646946;16632845,16635766,16638035,16646902,-16633559,16635910,16638088,16646946,
chr116678102166788681667870611.48170immediateDownstreamjonctionup-regulated0.2-20980Ly96chr1:16678536-16699686;16678536,16681764,16690929,16696253,16699519,-16678700,16681854,16691004,16696306,16699686,
chr116678868166792041667907111.64535immediateDownstreamf_intronup-regulated0.2-20615Ly96chr1:16678536-16699686;16678536,16681764,16690929,16696253,16699519,-16678700,16681854,16691004,16696306,16699686,
chr123389930233905612339042614.536-412promoterNAup-regulated0.66-17164Ogfrl1chr1:23373262-23390014;23373262,23382568,23382826,23383009,23385564,23385810,23389653,-23377287,23382714,23382893,23383088,23385643,23385897,23390014,
chr134515797345163813451607110.731-519promoterNAup-regulated0.22-14553Ptpn18chr1:34516590-34530624;34516590,34519546,34519951,34520113,34520310,34525137,34526684,34527044,34528337,34528485,34528656,34528947,34529607,34530179,34530423,-34516761,
34519655,34520028,34520209,34520349,34525206,34526747,34527187,34528404,34528563,34528746,34529036,34529813,34530254,34530624,
90: central regions for Filter on data 86
31 regions
format: bed, database: mm9
1.Chrom2.Start3.End4.Name
chr1166469771664727726.047
chr1166785561667885611.48
chr1166789211667922111.64
chr1233902762339057614.536
chr1345159213451622110.731
chr1345167843451708430.076
91: Fasta file
31 sequences
format: fasta, database: mm9
>chr1:16646977-16647277
CCCCCAGCGGCCTACCCCTGTGGGTTCCGGGGCACAGAAAGGAATTACTTCCGTCGCGTCACAGCCGCTTTCTGTAACGCGCGGGAGACTGGTACCTGGCAAGGCCGAGACGCGATCTGCCGGTAACTTGCGTCTGGAGGAAGTGCGTTGTGGGCAGTAAAACAGGCCCATTTAAGAGACATCGCTACCAAATCCCAACCAATGAGATGCTAGGACTTCTTGGTTCCCAGAATGCAGCGCCATCCGGATCCAATTT
CTGCCGAGAAAAGCTGAGCCGGCGAGGCAGCAGTGCATTCTGGG
>chr1:16678556-16678856
TGGCGAGTTTAAAGTATCGGAGATATTAAATCATGTTGCCATTTATTCTCTTTTCGACGCTGCTTTCTCCCATATTGACTGAATCTGAGAAGCAACAGTGGTTCTGCAACTCCTCCGATGCAATTATTTCCTACAGTTATTGTGGTAAGTGGCCCGGCAACAAAGAGCTGCGGCGCCAACTATTTCGAGAGAAAGTTTCCACTGAACCTGAAGCTGGAGGGCTGGCAGGAACGCTGCTCCAGCAGTGAGCCCGCTG
CGGTGTGGGGTGGGGGTGGAGCAATGCCGACCACTTCCGGGTGC
92: row ChIPmunk output for ChIPseq (log)
135 lines
format: txt, database: mm9
DUMP|ru_genetika.ChIPHorde
PROG|ru_genetika.ChIPHorde
INFO|motif N0
LENG|17
KDIC|11.905831052483956
A|1.0 21.0 2.0 16.0 8.0 9.0 14.0 14.0 21.0 6.0 3.0 2.0 4.0 3.0 0.0 9.0 0.0
93: motifs for ChIPseq(txt)
15 lines
format: txt, database: mm9
Motif 1
A| 1 21 2 16 8 9 14 14 21 6 3 2 4 3 0 9 0
C| 0 1 0 4 5 1 0 3 0 5 1 10 3 0 9 2 0
G| 28 2 27 9 16 17 9 12 8 17 19 15 0 26 17 10 25
T| 0 5 0 0 0 2 6 0 0 1 6 2 22 0 3 8 4
Motif 2
94: motifs for ChIPseq(png)
263.6 Kb
format: png, database: mm9
Image in png format
95: GSM714805_NCC_input_aligned.bed
~15,000,000 regions
format: bed, database: hg18
1.Chrom2.Start3.End4.Name56.Strand789
track name="RX_noIP_tags" description="RX_noIP_tags" priority=96.321091930142 visibility=4 itemRgb="On"
chr1 2916 2920 QuEST_align 0 + 2916 2920 025,025,112
chr1 6098 6102 QuEST_align 0 + 6098 6102 025,025,112
chr1 49110 49114 QuEST_align 0 + 49110 49114 025,025,112
chr1 50115 50119 QuEST_align 0 + 50115 50119 025,025,112
chr1 53166 53170 QuEST_align 0 + 53166 53170 025,025,112
96: GSM714807_NCC_H3K27ac_aligned.bed
~15,000,000 regions
format: bed, database: hg18
1.Chrom2.Start3.End4.Name56.Strand789
track name="H3K27ac_preNCC_270410_cutoff20_tags" description="H3K27ac_preNCC_270410_cutoff20_tags" priority=64.5 visibility=4 itemRgb="On"
chr1 2934 2938 QuEST_align 0 + 2934 2938 127,255,212
chr1 3179 3183 QuEST_align 0 + 3179 3183 127,255,212
chr1 4792 4796 QuEST_align 0 + 4792 4796 127,255,212
chr1 4794 4798 QuEST_align 0 + 4794 4798 127,255,212
chr1 9100 9104 QuEST_align 0 + 9100 9104 127,255,212
97: H3K27ac histone peaks (bed)
~1,100,000 regions
format: bed, database: hg18
1.Chrom2.Start3.End4.Name56.Strand7
chr167382419973855350peak1301.693.73843049
chr177288669972918450peak2296.533.72901949
chr1961608496191500peak3288.111.6168599
chr174341249943440200peak4272.552.43425449
chr1643593494385900peak5261.021.4382899
chr1722276492252750peak6235.042.2243149
98: H3K27ac histone regions (bed)
~1,000,000 regions
format: bed, database: hg18
1.Chrom2.Start3.End4.Name56.Strand7
chr1183189949183190200peak13.199e+27.0
chr167382379973855350peak2301.693.73823849
chr177287899972918450peak3296.533.72881199
chr1961608496191850peak4288.111.6168599
chr174341249943440850peak5272.552.43425449
chr1643582994386550peak6261.021.4358649
99: H3K27ac density profile (wig)
~55,000,000 lines
format: wig, database: hg18
1
track name="H3K27ac" type=wig visibility=2
fixedStep chrom=chr1 start=183189300 step=50
0
0
0
0
100: HMCan log report (txt)
352 lines
format: txt, database: hg18
gccount: calculate GC-profile
..windows size was set to 87233
..Output directory: .
..Directory with files containing chromosome sequences: /data/annotations/Galaxy/Human/hg18/chromosomes
..Step: 87233
..File with chromosome lengths: /data/annotations/Galaxy/Human/hg18/hg18.len
101: H3K27ac histone peaks (bed)
37,071 regions
format: bed, database: hg18
1.Chrom2.Start3.End4.Name56.Strand7
chr177295024973001100peak1355.93.72958949
chr35206019952105200peak2308.047.52065649
chr1911849991227900peak3299.073.1201949
chr177287824972914400peak4247.76.72881449
chr167382414973859350peak5242.043.73857299
chr174340684943440900peak6241.19.43427449
102: H3K27ac histone regions (bed)
36,724 regions
format: bed, database: hg18
1.Chrom2.Start3.End4.Name56.Strand7
chr1183189749183190100peak16.50448e+22.0
chr177292339973001100peak2355.93.72941299
chr35205349952105200peak3308.047.52055249
chr1911849991227900peak4299.073.1201949
chr177287824972914400peak5247.76.72881449
chr167382414973859350peak6242.043.73857299
103: H3K27ac density profile (wig)
~54,000,000 lines
format: wig, database: hg18
1
track name="H3K27ac" type=wig visibility=2
fixedStep chrom=chr1 start=183189300 step=50
0
0
0
0
104: HMCan log report (txt)
352 lines
format: txt, database: hg18
gccount: calculate GC-profile
..windows size was set to 87233
..Output directory: .
..Directory with files containing chromosome sequences: /data/annotations/Galaxy/Human/hg18/chromosomes
..Step: 87233
..File with chromosome lengths: /data/annotations/Galaxy/Human/hg18/hg18.len
106: H3K27ac.bam
666.8 Mb
format: bam, database: hg19
Info: [bam_sort_core] merging from 5 files...
[bam_sort_core] merging from 5 files...
Binary bam alignments file
107: input.bam
658.8 Mb
format: bam, database: hg19
Info: [bam_sort_core] merging from 5 files...
[bam_sort_core] merging from 5 files...
Binary bam alignments file
112: H3K27ac_hg19_NCC histone peaks (bed)
40,781 regions
format: bed, database: hg19
1.Chrom2.Start3.End4.Name56.Strand7
chr35207839952130200peak1362.572.52090549
chr177543919975489500peak2349.668.75447399
chr1959212995969750peak3326.006.5950999
chr9137255949137301650peak4312.696.137299199
chr35026414950308850peak5312.156.50298049
chr1912339991277350peak6301.931.1250899
113: H3K27ac_hg19_NCC histone regions (bed)
40,363 regions
format: bed, database: hg19
1.Chrom2.Start3.End4.Name56.Strand7
chr1817899818250peak14.48437e+30.0
chr35207839952130200peak2362.572.52090549
chr177540289975489500peak3349.668.75409199
chr1959212995969750peak4326.006.5950999
chr9137255949137301650peak5312.696.137299199
chr35026414950308850peak6312.156.50298049
114: H3K27ac_hg19_NCC density profile (wig)
~59,000,000 lines
format: wig, database: hg19
1
track name="H3K27ac_hg19_NCC" type=wig visibility=2
fixedStep chrom=chr1 start=800000 step=50
0
0
1
1
115: HMCan log report (txt)
328 lines
format: txt, database: hg19
gccount: calculate GC-profile
..windows size was set to 80000
..Output directory: .
..Directory with files containing chromosome sequences: /data/annotations/Galaxy/Human/hg19/chromosomes
..Step: 80000
..File with chromosome lengths: corrected_hg19Len_file.len