Analyze Data Workflow Shared Data Help User
Using 0 bytes
Published Histories | alermine | Precompute ENS - 3 Juin 2013
Import history

Galaxy History ' Precompute ENS - 3 Juin 2013'


DatasetAnnotation
15: Input_chr1.bam
158.4 Mb
format: bam, database: mm9
Info: uploaded bam file
Binary bam alignments file
16: TF_chr1.bam
146.2 Mb
format: bam, database: mm9
Info: uploaded bam file
Binary bam alignments file
17: FindPeaks for chip (peaks: .peaks)
244,738 lines
format: txt, database: mm9
0 chr1 3000274 3000754 3000378 2.001
1 chr1 3000754 3001340 3001001 1.723
2 chr1 3001340 3001708 3001435 1.0
3 chr1 3001708 3002521 3001946 2.329
4 chr1 3002521 3003061 3002855 2.998
5 chr1 3003061 3003427 3003270 1.0
18: FindPeaks for chip (report)
48 lines
format: log, database: mm9
Info: Log File: /data/tmp/atelierINSERM/1/chip.log
Info: * Output directory : /data/tmp/atelierINSERM/1/
Info: * Naming files as : chip
Info: * MC simulation : Off
Info: * Chr name prepend : none
Info: * Min. reported pk ht : 0
19: FindPeaks for chip (wig)
~880,000 lines
format: wig, database: mm9
123456789
gzipped file
20: FindPeaks for control (peaks: .peaks)
232,267 lines
format: txt, database: mm9
0 chr1 3000357 3001089 3000942 2.967
1 chr1 3001089 3001382 3001117 2.007
2 chr1 3001382 3001723 3001467 3.0
3 chr1 3001723 3001995 3001945 1.0
4 chr1 3002069 3003216 3002545 4.591
5 chr1 3003581 3003930 3003825 1.0
21: FindPeaks for control (report)
48 lines
format: log, database: mm9
Info: Log File: /data/tmp/atelierINSERM/1/control.log
Info: * Output directory : /data/tmp/atelierINSERM/1/
Info: * Naming files as : control
Info: * MC simulation : Off
Info: * Chr name prepend : none
Info: * Min. reported pk ht : 0
22: FindPeaks for control (wig)
data
format: gzip, database: mm9
display at UCSC main
23: Peak height distribution (stats)
49 lines
format: tabular, database: mm9
Info: null device
1
12345
peak height# peaks in ChIP# peaks in Control#control/chip
345395415900.916180196056834
438476408971.06292234119971
528284336761.19063781643332
617608233081.32371649250341
79991134931.35051546391753
24: Peak height distribution (png)
7.6 Kb
format: png, database: mm9
Info: null device
1
Image in png format
25: filtered peaks for ChIP (.bed)
2,091 regions, 1 comments
format: bed, database: mm9
1.Chrom2.Start3.End4.Name56.Strand78910111213
track name='ChIP' description='ChIP'
chr130422883043498304286317.886+30422883043498255,120,11112100
chr130489483050298304988227.505+30489483050298255,120,11113500
chr134298193430572343025520.678+34298193430572255,120,1117530
chr138590673859705385943517.0+38590673859705255,120,1116380
chr138862623887635388733419.829+38862623887635255,120,11113730
26: filtered peaks for Control (.bed)
88 regions, 1 comments
format: bed, database: mm9
1.Chrom2.Start3.End4.Name56.Strand78910111213
track name='Control' description='Control'
chr151023155103470510301325.622+51023155103470255,120,11111550
chr166539696654769665445114.891+66539696654769255,120,1118000
chr110377284103782831037812817.258+1037728410378283255,120,1119990
chr118876763188777881887704516.153+1887676318877788255,120,11110250
chr1246180562462363024620752184.730+2461805624623630255,120,11155740
27: Probesets_FC1.5_10022011.txt
16,142 lines
format: tabular, database: mm9
Info: uploaded tabular file
12345678
geneFold.Changepvalue.adjustFC=1.5
A0610010O12Rik2.54down-regulateddown-regulated474
A0910001A06Rik0.556666667up-regulatedno-response14871
A1110002B05Rik0.51up-regulatedup-regulated796
A1110003E01Rik1.575down-regulated
A1110006G14Rik1.68down-regulated
28: Peak location distribution (png)
120.0 Kb
format: png, database: mm9
Image in png format
29: Peak location distribution (stats)
52 lines
format: tabular, database: mm9
12345678910
Dist_TSS % genes w/ a peak in ChIP % genes w/ a peak in control % down-regulated genes w/ a peak in ChIP % no-response genes w/ a peak in ChIP % up-regulated genes w/ a peak in ChIP % down-regulated genes w/ a peak in Control % no-response genes w/ a peak
in Control % up-regulated genes w/ a peak in Control
000000000
10000.008628165105792584.33576135969476e-050.005988023952095810.007600165220983070.027283511269276408.26104915324246e-050
20000.01096947624002770.0001300728407908430.009980039920159680.009913258983890950.03321470937129300.0002478314745972740
30000.01248699271592090.0002167880679847380.01197604790419160.01131763733994220.035587188612099600.0003304419661296980
30: Peaks Stats (png)
50.3 Kb
format: png, database: mm9
Image in png format
31: Annotated Peaks (ChIP)
2,133 lines
format: tabular, database: mm9
12345678910111213
ChromosomeStartEndMaxScoreDistTSSTypeTypeIntraRegFoldChangeDistTEGeneNameGeneCoordinates
chr130422883043498304286317.886618716intergenicNANA1161699Xkr4chr1:3204562-3661579;3204562,3411782,3660632,-3207049,3411982,3661579,
chr130489483050298304988227.505611697intergenicNANA1154680Xkr4chr1:3204562-3661579;3204562,3411782,3660632,-3207049,3411982,3661579,
chr134298193430572343025520.678231324intragenicf_intronNA1-225693Xkr4chr1:3204562-3661579;3204562,3411782,3660632,-3207049,3411982,3661579,
chr138590673859705385943517-197856intergenicNANA1-654873Xkr4chr1:3204562-3661579;3204562,3411782,3660632,-3207049,3411982,3661579,
chr138862623887635388733419.829-225755intergenicNANA1-682772Xkr4chr1:3204562-3661579;3204562,3411782,3660632,-3207049,3411982,3661579,
32: .LOG for Annotated Peaks
30 lines, 1 comments
format: tabular, database: mm9
123
ChIP:
Total genes : 25714
Total Sites: 2091
TypeCountFrequency
5kbDownstream570.0267354596622889
enhancer3000.140712945590994
33: Annotated Peaks (Control)
92 lines
format: tabular, database: mm9
12345678910111213
ChromosomeStartEndMaxScoreDistTSSTypeTypeIntraRegFoldChangeDistTEGeneNameGeneCoordinates
chr144347639443495324434935514.746-73579intergenicNAno-response0.987264488-884414832428D23Rikchr1:44260914-44275776;44260914,44267008,44267876,44274955,44275684,-44263598,44267126,44268043,44275075,44275776,
chr185276118852792848527850130.546-11360enhancerNANA1-35583C130026I21Rikchr1:85242918-85267141;85242918,85244873,85250677,85251088,85256269,85257311,85266607,-85243711,85244954,85250758,85251151,85256441,85257474,85267141,
chr114961947514962036614961971519.331274899intergenicNANA1870113Fam5cchr1:148344816-148749602;148344816,148361797,148529705,148548785,148593609,148598884,148678690,148748130,-148344870,148362083,148529896,148548976,148593715,148599121,148678913
,148749602,
chr190129280901310039012986517.0146271intragenicjonctionNA1-28999Heatr7b1chr1:90123594-90158864;90123594,90124628,90124801,90126916,90127200,90128818,90129891,90130576,90131163,90131528,90131764,90131947,90133229,90134047,90134419,90135468,9013
34: Gene Stats (png)
35.3 Kb
format: png, database: mm9
Image in png format
35: Annotated Genes (ChIP)
25,715 lines
format: tabular, database: mm9
1234567891011121314151617181920212223242526272829303132333435363738394041
name chr start end strand Reg foldChange TF_score_Gene TF_distTSS_Gene TF_score_Promoter TF_distTSS_Promoter TF_score_ImmDown TF_distTSS_ImmDown TF_score_PromoterORImmDown TF_distTSS_PromoterORImmDown TF_score_Enhancer TF_distTSS_Enhancer TF_score_Intragen
ic TF_distTSS_Intragenic TF_score_GeneDownstream TF_distTSS_GeneDownstream TF_score_FirstExon TF_distTSS_FirstExon TF_score_FisrtIntron TF_distTSS_FisrtIntron TF_score_FirstExonAND>2000 TF_distTSS_FirstExonAND>2000 TF_score_FisrtIntronAND>2000 TF_distTSS_F
isrtIntronAND>2000 TF_score_Exons2,3,4,etc TF_distTSS_Exons2,3,4,etc TF_score_Exons2,3,4,etcAND>2000 TF_distTSS_Exons2,3,4,etcAND>2000 TF_score_Introns2,3,4,etc TF_distTSS_Introns2,3,4,etc TF_score_Introns2,3,4,etcAND>2000 TF_distTSS_Introns2,3,4,etcAND>20
00 TF_score_EIjunction TF_distTSS_EIjunction TF_score_EIjunctionAND>2000 TF_distTSS_EIjunctionAND>2000
Ucp3 chr7 107621499 107634941 1 no-response 0.979843327 0 10000000000 0 10000000000 0 10000000000 0 10000000000 0 10000000000 0 10000000000 0 10000000000 0 10000000000 0 10000000000 0 10000000000 0 10000000000 0 10000000000 0 10000000000 0 10000000000 0 10
000000000 0 10000000000 0 10000000000
36: .LOG for Annotated Genes
23 lines, 3 comments
format: tabular, database: mm9
1
Proportion of genes with a peak from the ChIP dataset in a given genomic region:
down-regulated:
Enh. Prom. Imm.Down. Intrag. GeneDown. F.Intron Exons 2,3,etc.Introns E.I.Junctions
0.04 0.00235294117647059 0.00941176470588235 0.0235294117647059 0.00705882352941176 0.00941176470588235 0 0.0188235294117647 0.00235294117647059
no-response:
Enh. Prom. Imm.Down. Intrag. GeneDown. F.Intron Exons 2,3,etc.Introns E.I.Junctions
37: Annotated Genes (Control)
25,715 lines
format: tabular, database: mm9
1234567891011121314151617181920212223242526272829303132333435363738394041
name chr start end strand Reg foldChange TF_score_Gene TF_distTSS_Gene TF_score_Promoter TF_distTSS_Promoter TF_score_ImmDown TF_distTSS_ImmDown TF_score_PromoterORImmDown TF_distTSS_PromoterORImmDown TF_score_Enhancer TF_distTSS_Enhancer TF_score_Intragen
ic TF_distTSS_Intragenic TF_score_GeneDownstream TF_distTSS_GeneDownstream TF_score_FirstExon TF_distTSS_FirstExon TF_score_FisrtIntron TF_distTSS_FisrtIntron TF_score_FirstExonAND>2000 TF_distTSS_FirstExonAND>2000 TF_score_FisrtIntronAND>2000 TF_distTSS_F
isrtIntronAND>2000 TF_score_Exons2,3,4,etc TF_distTSS_Exons2,3,4,etc TF_score_Exons2,3,4,etcAND>2000 TF_distTSS_Exons2,3,4,etcAND>2000 TF_score_Introns2,3,4,etc TF_distTSS_Introns2,3,4,etc TF_score_Introns2,3,4,etcAND>2000 TF_distTSS_Introns2,3,4,etcAND>20
00 TF_score_EIjunction TF_distTSS_EIjunction TF_score_EIjunctionAND>2000 TF_distTSS_EIjunctionAND>2000
Ucp3 chr7 107621499 107634941 1 no-response 0.979843327 0 10000000000 0 10000000000 0 10000000000 0 10000000000 0 10000000000 0 10000000000 0 10000000000 0 10000000000 0 10000000000 0 10000000000 0 10000000000 0 10000000000 0 10000000000 0 10000000000 0 10
000000000 0 10000000000 0 10000000000
38: Filter on data 31
30 lines
format: tabular, database: mm9
Info: Filtering with (c7=='promoter' or c7=='immediateDownstream') and c9=='up-regulated',
kept 1.41% of 2133 valid lines (2133 total lines).
12345678910111213
chr116646169166481821664712738.833-181promoterNAup-regulated0.54-14282Tceb1chr1:16632845-16646946;16632845,16635766,16638035,16646902,-16633559,16635910,16638088,16646946,
chr116677870166795961667870615.462170immediateDownstreamjonctionup-regulated0.2-20980Ly96chr1:16678536-16699686;16678536,16681764,16690929,16696253,16699519,-16678700,16681854,16691004,16696306,16699686,
chr123389726233917732339036719.548-353promoterNAup-regulated0.66-17105Ogfrl1chr1:23373262-23390014;23373262,23382568,23382826,23383009,23385564,23385810,23389653,-23377287,23382714,23382893,23383088,23385643,23385897,23390014,
chr134513642345164353451603014.511-560promoterNAup-regulated0.22-14594Ptpn18chr1:34516590-34530624;34516590,34519546,34519951,34520113,34520310,34525137,34526684,34527044,34528337,34528485,34528656,34528947,34529607,34530179,34530423,-34516761,
34519655,34520028,34520209,34520349,34525206,34526747,34527187,34528404,34528563,34528746,34529036,34529813,34530254,34530624,
chr134516435345182193451713646.456546immediateDownstreamf_intronup-regulated0.22-13488Ptpn18chr1:34516590-34530624;34516590,34519546,34519951,34520113,34520310,34525137,34526684,34527044,34528337,34528485,34528656,34528947,34529607,34530179,345
39: central regions for Filter on data 31
30 regions
format: bed, database: mm9
1.Chrom2.Start3.End4.Name
chr1166469771664727738.833
chr1166785561667885615.462
chr1233902172339051719.548
chr1345158803451618014.511
chr1345169863451728646.456
chr1387213723872167218.094
42: Fasta file
30 sequences
format: fasta, database: mm9
>chr1:16646977-16647277
CCCCCAGCGGCCTACCCCTGTGGGTTCCGGGGCACAGAAAGGAATTACTTCCGTCGCGTCACAGCCGCTTTCTGTAACGCGCGGGAGACTGGTACCTGGCAAGGCCGAGACGCGATCTGCCGGTAACTTGCGTCTGGAGGAAGTGCGTTGTGGGCAGTAAAACAGGCCCATTTAAGAGACATCGCTACCAAATCCCAACCAATGAGATGCTAGGACTTCTTGGTTCCCAGAATGCAGCGCCATCCGGATCCAATTT
CTGCCGAGAAAAGCTGAGCCGGCGAGGCAGCAGTGCATTCTGGG
>chr1:16678556-16678856
TGGCGAGTTTAAAGTATCGGAGATATTAAATCATGTTGCCATTTATTCTCTTTTCGACGCTGCTTTCTCCCATATTGACTGAATCTGAGAAGCAACAGTGGTTCTGCAACTCCTCCGATGCAATTATTTCCTACAGTTATTGTGGTAAGTGGCCCGGCAACAAAGAGCTGCGGCGCCAACTATTTCGAGAGAAAGTTTCCACTGAACCTGAAGCTGGAGGGCTGGCAGGAACGCTGCTCCAGCAGTGAGCCCGCTG
CGGTGTGGGGTGGGGGTGGAGCAATGCCGACCACTTCCGGGTGC
43: row ChIPmunk output for ENS (log)
131 lines
format: txt, database: mm9
DUMP|ru_genetika.ChIPHorde
PROG|ru_genetika.ChIPHorde
INFO|motif N0
LENG|15
KDIC|11.773073132931453
A|4.0 1.0 21.0 0.0 1.0 0.0 0.0 0.0 0.0 0.0 0.0 3.0 2.0 8.0 10.0
44: motifs for ENS(txt)
15 lines
format: txt, database: mm9
Motif 1
A| 4 1 21 0 1 0 0 0 0 0 0 3 2 8 10
C| 8 16 0 23 0 0 26 26 5 20 8 14 7 10 12
G| 10 5 2 4 0 0 0 0 1 3 0 0 6 7 4
T| 5 5 4 0 26 27 1 1 21 4 19 10 12 2 1
Motif 2
45: motifs for ENS(png)
311.4 Kb
format: png, database: mm9
Image in png format
50: row ChIPmunk output for ENS (log)
132 lines
format: txt, database: mm9
DUMP|ru_genetika.ChIPHorde
PROG|ru_genetika.ChIPHorde
INFO|motif N0
LENG|15
KDIC|12.517388938648875
A|4.0 1.0 1.0 0.0 12.0 9.0 15.0 3.0 17.0 0.0 1.0 23.0 23.0 0.0 2.0
51: motifs for ENS(txt)
15 lines
format: txt, database: mm9
Motif 1
A| 4 1 1 0 12 9 15 3 17 0 1 23 23 0 2
C| 7 10 3 5 6 0 0 1 1 0 0 0 0 2 2
G| 9 5 11 11 4 12 8 19 5 23 22 0 0 21 1
T| 3 7 8 7 1 2 0 0 0 0 0 0 0 0 18
Motif 2
52: motifs for ENS(png)
257.6 Kb
format: png, database: mm9
Image in png format
55: chr4.bam
966.1 Kb
format: bam, database: hg19
Binary bam alignments file
56: flagstat on data 55
11 lines
format: txt, database: hg19
19799 + 0 in total (QC-passed reads + QC-failed reads)
19082 + 0 duplicates
19387 + 0 mapped (97.92%:-nan%)
0 + 0 paired in sequencing
0 + 0 read1
0 + 0 read2
75: FindPeaks for chip (peaks: .peaks)
46 lines
format: txt, database: hg19
0 chr4 1803342 1803636 1803586 1.0
1 chr4 1806109 1806403 1806159 1.0
2 chr4 1807840 1808096 1807890 1.0
3 chr4 1808096 1808630 1808355 6.0
4 chr4 1808714 1809230 1808972 2.0
5 chr4 8240773 8241067 8241017 1.0
76: FindPeaks for chip (report)
53 lines
format: log, database: hg19
Version: Vancouver Short Read Analysis Package 4.0.9.2
Version: Initializing class FindPeaks $Revision: 1797 $
Version: Initializing class Parameters $Revision: 1838 $
Info: Log File: /scratch/477531.torque.curie.fr/tmp.WvTf90dpx5/chip.log
Info: * Output directory : /scratch/477531.torque.curie.fr/tmp.WvTf90dpx5/
Info: * Naming files as : chip
77: FindPeaks for chip (wig)
data
format: gzip, database: hg19
display at UCSC main
87: MACS on data 15 (peaks: bed)
33,433 regions
format: bed, database: mm9
1.Chrom2.Start3.End4.Name5
chr130025403002545MACS_peak_153.35
chr130068043006808MACS_peak_250.38
chr130069713006975MACS_peak_350.11
chr130087233008729MACS_peak_463.41
chr130088143008816MACS_peak_591.27
chr130095883009592MACS_peak_650.38
88: MACS on data 15 (treatment: wig)
~420,000 lines
format: wig, database: mm9
12
track type=wiggle_0 name="MACS_in_Galaxy_treat_chr1" description="Extended tag pileup from MACS version 1.4.2 20120305 for every 10 bp"
variableStep chrom=chr1 span=10
30005411
30008311
30010911
30014011
89: MACS on data 15 (html report)
2.8 Kb
format: html, database: mm9
HTML file
91: MACS on data 15 (peaks: bed)
An error occurred running this job: ERROR:root:No such file: /data/tmp/atelierINSERM/Input_chr1.bam!
92: MACS on data 15 (treatment: wig)
An error occurred running this job: ERROR:root:No such file: /data/tmp/atelierINSERM/Input_chr1.bam!
93: MACS on data 15 (html report)
An error occurred running this job: ERROR:root:No such file: /data/tmp/atelierINSERM/Input_chr1.bam!