Upload File
Which format? See help below
WARNING!!! Due to browser limitations, uploading files larger than 2GB is guaranteed to fail. To upload large files, use the URL method (below) trough FTP/HTTP protocol. In order to use this method, you should have access to an open websever or ftp server where you should put the data you want to upload. This server has to be accessible from outside. If you don't have access to any webserver or ftp server, you need to install yours. Here is some example of servers that are free and can be easily installed Web servers: MAMP for Mac (http://www.mamp.info/en/index.html) WAMP for Windows (http://www.wampserver.com/) Ftp servers: FileZilla Server for Windows (http://filezilla-project.org/download.php?type=server) Pure-FTPd for Mac (http://www.pureftpd.org/project/pure-ftpd) Once you have your own server installed, put your data in and copy the url to the file (http://publicIP/path/to/file or ftp://user:passw@publicIP/path/to/file). Then paste the url into the URL/Text box of the upload tool. Click on execute, the upload will start! A more complete tutorial can be found at the main Galaxy server: https://main.g2.bx.psu.edu/ -> Live Quickies: Uploading Data using FTP, Galactic quickie #17
Here you may specify a list of URLs (one per line) or paste the contents of a file.
Use this option if you are entering intervals by hand.

Auto-detect

The system will attempt to detect Axt, Fasta, Fastqsolexa, Gff, Gff3, Html, Lav, Maf, Tabular, Wiggle, Bed and Interval (Bed with headers) formats. If your file is not detected properly as one of the known formats, it most likely means that it has some format problems (e.g., different number of columns on different rows). You can still coerce the system to set your data to the format you think it should be. You can also upload compressed files, which will automatically be decompressed.


Ab1

A binary sequence file in 'ab1' format with a '.ab1' file extension. You must manually select this 'File Format' when uploading the file.


Axt

blastz pairwise alignment format. Each alignment block in an axt file contains three lines: a summary line and 2 sequence lines. Blocks are separated from one another by blank lines. The summary line contains chromosomal position and size information about the alignment. It consists of 9 required fields.


Bam

A binary file compressed in the BGZF format with a '.bam' file extension.


Bed


Fasta

A sequence in FASTA format consists of a single-line description, followed by lines of sequence data. The first character of the description line is a greater-than (">") symbol in the first column. All lines should be shorter than 80 characters:

>sequence1
atgcgtttgcgtgc
gtcggtttcgttgc
>sequence2
tttcgtgcgtatag
tggcgcggtga

FastqSolexa

FastqSolexa is the Illumina (Solexa) variant of the Fastq format, which stores sequences and quality scores in a single file:

@seq1
GACAGCTTGGTTTTTAGTGAGTTGTTCCTTTCTTT
+seq1
hhhhhhhhhhhhhhhhhhhhhhhhhhPW@hhhhhh
@seq2
GCAATGACGGCAGCAATAAACTCAACAGGTGCTGG
+seq2
hhhhhhhhhhhhhhYhhahhhhWhAhFhSIJGChO

Or:

@seq1
GAATTGATCAGGACATAGGACAACTGTAGGCACCAT
+seq1
40 40 40 40 35 40 40 40 25 40 40 26 40 9 33 11 40 35 17 40 40 33 40 7 9 15 3 22 15 30 11 17 9 4 9 4
@seq2
GAGTTCTCGTCGCCTGTAGGCACCATCAATCGTATG
+seq2
40 15 40 17 6 36 40 40 40 25 40 9 35 33 40 14 14 18 15 17 19 28 31 4 24 18 27 14 15 18 2 8 12 8 11 9

Gff

GFF lines have nine required fields that must be tab-separated.


Gff3

The GFF3 format addresses the most common extensions to GFF, while preserving backward compatibility with previous formats.


Interval (Genomic Intervals)


Lav

Lav is the primary output format for BLASTZ. The first line of a .lav file begins with #:lav..


MAF

TBA and multiz multiple alignment format. The first line of a .maf file begins with ##maf. This word is followed by white-space-separated "variable=value" pairs. There should be no white space surrounding the "=".


Scf

A binary sequence file in 'scf' format with a '.scf' file extension. You must manually select this 'File Format' when uploading the file.


Sff

A binary file in 'Standard Flowgram Format' with a '.sff' file extension.


Tabular (tab delimited)

Any data in tab delimited format (tabular)


Wig

The wiggle format is line-oriented. Wiggle data is preceded by a track definition line, which adds a number of options for controlling the default display of this track.


Other text type

Any text file