RSAT Peak Motifs
If your motif database of interest is not listed, contact the RSAT team

What it does

This tool is a pipeline for discovering motifs in massive ChIP-seq peak sequences.


Example with FASTA file (1000 sequences):

>mm9_chr3_121848111_121848740_+
tggggtgggttccaggacagccaggactgtcacacaaagaaaccttgtctcaaaaaaaca
aaaCAAAAAACAAAACAAAACCAAGCAAGCAAGCAAACATGGGCTTAAATctggatacag
tggcctttatttctagttccagtgactgggagactgaaacaagagagtcacttgagtaca
ggagtgcaaggctagcttgagcaatatagtaagactatctcaaaaTGTGAATTtagatca
acagaattgacatcaagaaaaatactgatatcactcaaagcaatctacagattcaacaca
atctccatcaacatgacaatgacttccatcaGCATGACAATGACTCCATCAACATGCCAA
TGGGCCCCATCAACATAACAATGACCCCTATCATCATGACAATGATCCCCATCAACATGA
CAATGACCTCCATCAACATGACAATTACTCCTGTCAACATGCCAATtgttggggttcaga
agtcaccctgcaaaccacaagaacactaatctcagtcaagcagggatggtttactgaacg
tatatccaaagactgagtgaccaagggaacagctcagactctagagctgaaagctagctg
tgcgctggacatttctcggggccaactta
>mm9_chr14_86795691_86796311_+
CTCAAGGAGGATCCAGAAGTTGGCAGTTTCTGAGGCGAGTCCCATATTCCTCCCCTAAGG
GGTCAGGATTTTTCAGGTCTGGGCTCTTCTTGTTCTTTTGACAGCGACATTAATAATTGT
ACCAGCTCTCCCCTGGCAGGGCCGCACCACAGAGTAAAGCCTGGAGTAGGAGCTGTGCCC
AGCGCAATAATACCAGTTAAATAAGTACGTTCATTACCTCCCAACAGTCAAGGAGTTTAA
AATCCGTCAATTCACCCCACATGAGGGAGATTATGTGATTTACATGTTAAAGTGCCCCTG
TGGTTTGATTTGCATAGCAAAGACTTTGGGGGCACAGAAACAAAGCATCCGCATGCATGA
CAAGAGGACTATTAGCATAGAGAGAGCAGGTTTTCCGACAGCCCAGCCTGGCAAACAATG
CTGCACCTTCGCTGCTCGCTGGAGTTTATAGGATTTGACAGTTTCTCATCTGAGGGAGGA
GAAGGTTAGGGAGTTGGGGTGGAATGAGGTTCGCTAGATTGGCTGTCTGCCTTAAGCACA
ATAATTTGTCTTTCTCTGAAGACCTCCCCTCCTCTTATCACCTTTATCGTTTCTTTCTGA
TGTTCATTCAAAGACGTCTT

Partial results :

static/images/result_peak_motifs_1.png static/images/result_peak_motifs_2.png

Citation

For the underlying tool, please cite Thomas-Chollier, M., Herrmann, C., Defrance, M., Sand, O., Thieffry, D. and van Helden, J. (2011). RSAT peak-motifs: motif analysis in full-size ChIP-seq datasets. Nucleic Acids Research doi:10.1093/nar/gkr1104, 9.