Fastqc: Fastqc QC
tab delimited file with 2 columns: name and sequence. For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA

Purpose

FastQC aims to provide a simple way to do some quality control checks on raw sequence data coming from high throughput sequencing pipelines. It provides a modular set of analyses which you can use to give a quick impression of whether your data has any problems of which you should be aware before doing any further analysis.

The main functions of FastQC are:

FastQC documentation

This is a Galaxy interface to the external package FastQC. Specific documentation on FastQC can be found on that site. FastQC incorporates the Picard-tools libraries for sam/bam processing.

The contaminants file parameter was borrowed from the independently developed fastqcwrapper contributed to the Galaxy Community Tool Shed by J. Johnson.


Inputs and outputs

This wrapper will accept any fastq file as well as sam or bam as the primary file to check. It will also take an optional file containing a list of contaminants information, in the form of a tab-delimited file with 2 columns, name and sequence.

The tool produces a single HTML output file that contains all of the results, including the following:

All except Basic Statistics and Overrepresented sequences are plots.